This was a very fun ctf 


Let's discuss Linux questions first .

1. What command is used to change file or director permissions.

Ans- chmod 

2. What does gerp stands for -

And -global regular expression print

3. command used to kill process 1337

Ans.- kill 1337

Now let's move to crypto challenges

1 . Rsa trivia 1


We were given with p=1299827 q=1299811 and we were asked to find n. We know that n =p*q or if you don't know you can start rsa cryptography on internet.

2 . Rsa trivia 2 

We were given p and n ant by using the same formula we can calute q by doing n/p and then we have to take last 3 digits as a flag.

3. Rotten tomatoes 

After seeing the name of this we can understand that it's a rot chipher.so I just googled rot chipber decoder and used it to get this flag.

We will actually find flag at first rotation 

cyberhack{25_Din_Me_Paisa_Gol_Sponsored_By_Laxmi_Funds}

4.tokyo Ghoul

 When we listen to audio given in the challenges me come to know that it might be a morce code. So I searched online for a morce code Audio decoder.

I got the this flag after at least trying for 10-15 time.

The flag was KANEKISANISHALFGHOULHALFHUMIN. We can covert this to flag format and then submit.

5.Mixed System 

Mixed everything up. Cipher- 99 121 98 101 114 104 97 99 107 123 01000111 01101111 01101111 01100100 01011111 01001100 01101001 01100110 01100101 5F 42 79 5F 113 145 150 154 141 156 151 046 107 105 141 172 171 175

When I read this name and saw this chipher its a mixture of decimal ,binary ,hex and octal so I took it by step by step then converted to all this to ascii values from online tools. 

6.keypad 

After seeing this name I remember that I saw something like this on ctf-katana GitHub repo I got there and I found that is a keypad of old Nokia devices 😅 so saw katana and decrypted it.

7.Same challenges 

After seeing this AGAATCCATACAAGTAGTAGAACGACAATCAAGACATTGAGACAGTTGAGAATCTTGCGAATGCCACACTTGACGACAATCACACAG

There are all ACGt so I remembered it it's a dna chipher so I got back to ctf-katana and decoded it manually using the table given there.

8. Joke 

At first I was having no idea what is this so I started searching google after some time I searched joke crypto ctf then I saw ctf katana at 2 nd results then I saw there this is ook! Crpto

So I searched for ook decoder then simply decoded it.

9. Dots Only, No Dashes?

After seeing this I totally got confused so I left it at that time but when I was seeing ctf katana for some other challenge then I remembered about tap code. So I just got to decoder.fr then decoded it.

10. Jumping Jack

I got to crypto then started randomly tried different chiphers the. I got that is a base 64 but when I decoded it  gave base 32 then I again decode it and got base 64 again after doing this again and again. I finally got the flag .

11. Let's nacho

I after seeing thisAfter seeing this I searched for  dance chifer decoder there I saw decoder.fr tool so I used it to decode this flag .

12. 0's/1's challenges

After seeing this if also thought it just a binary and we have to convert it ASCII so I tried many different ways but I failed most of the time . I actually lost hope for this challenges but when I was solveing some other challenge I was searching binary on decoder.fr there i saw something binary Fu*k then I remembered that is hint there was written that word Fu*k so I went at tool and decoded it finally.

13. BrainTap

When I saw this I was having idea that's its brainfu*k language so I decoded it and gotQ

NDQ0IDggNzc3NyA1NTUgNjY2IDQgNDQ0IDIyMiAyIDU1NSA2NiAy

Then I got this this whick looked like base64 so I decoded it and got

444 8 7777 555 666 4 444 222 2 555 66 2

Which was the same as phone chipher we used before so I get back to ctf katana and decoded it.

14. Colors 

After seeing the photo and word colors I searched google for color chipher decode.


Then I saw google images related to it there I found

Which I used to decode this.

15. Goar-on 


After reading the hint I searched Zelda chipher decoder there was first tool named goron language decoder which I used to decode this flag.

17.SubsWay

After seeing this challenge I was bit losted. But when half hour to ctf competition was remaining I thought that I will solve it so I started searching again . This time I searched YouTube for fking viruses there I saw a ctf solved vedio 

Then I just replaced all z to 0 and *=1 which gave as a binary code. 

18.Based 

After seeing the name I thought that is was a base 64 or 32 to so I tried it it was base 64 then we got base 32 and then again base 64 and at last we got the flag

cyberhack{Me-Myself-&-I_By_G-Eazy&BebeRexha}

19. Opposite direction 

By just writing this text backwards we will get out flag

cyberhack{r3v3rs3_m3}

20. Trolls

After seeing this decimal I converted it to ASCII

There I got cyberhack{this_is_a_real_flag} and more numbers. I tried this but I don't work so I move to the extra no's we got after finally trying many things I figured it that it's a base 8 I mean octal so I coverted it to ASCII and got 1 more cyberhack{this_is_the_flag} flag + more text that was hex  after converting to ASCII I got our final flag that is

cyberhack{you_came_a_long_way_congo!!!}

So thanks for reading my blog pls leave a comment below.




Previous Post Next Post
–>